When a protein exists in mono-, di- and tri-phosphorylated forms. The difference of a couple of phosphate groups has no significant effect on the overall relative molecular mass of the protein, hence a single band on SDS gels, but the small charge difference introduced on each molecule can be detected by

TLS Online TPP Program

#Question id: 3271

#Section 3: Genetics, Cellular and Molecular Biology

Consider hemophilia A, a clotting disorder caused by an X-linked recessive allele with a frequency (q) of approximately 1 in 10,000. The frequency of the disease among females and among male respectively

TLS Online TPP Program

#Question id: 3623

#Section 3: Genetics, Cellular and Molecular Biology

To carry out a complementation test, which of the following statement is correct?

TLS Online TPP Program

#Question id: 5154

#General Aptitude

476**0 is divisible by both 3 and 11. The non zero digits in the hundred’s and ten’s places are respectively

TLS Online TPP Program

#Question id: 13101

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 14417

#Section 5: Bioprocess Engineering and Process Biotechnology

Which size is suitable for following, match the following?

Products                               filter 'pore diameter( nm) 

I.  yeast and fungi              P• 0.6-1.2

II. Bacteria                           q . 0.4- 0.8 

III. Antibiotics                        r. 300-10^3

IV. Organic acid                       s. 10^3- 10^4