The structure of RNA differs from that of DNA, as RNA contains:

TLS Online TPP Program

#Question id: 14191

#Section 5: Bioprocess Engineering and Process Biotechnology

Consider a 1000-l CSTR in which biomass is being produced with glucose as the substrate. The microbial system follows a Monod relationship withn µ_m = 0.4 h^-1 , K_S = 1.5 g/l (an unusu ally high value), and the yield factor Y_X/S = 0.5 g biomass/g substrate consumed. If normal operation is with a sterile feed containing 10 g/l glucose at a rate of 100 l/h. What is the specific biomass production rate (g/l-h) at steady state?

_____________________

TLS Online TPP Program

#Question id: 2275

#Section 3: Genetics, Cellular and Molecular Biology

A gram-negative bacterium is enclosed by

TLS Online TPP Program

#Question id: 27212

#Section 5: Bioprocess Engineering and Process Biotechnology

State true or false.

There is no axial mixing in a plug flow reactor.

a) True

b) False

TLS Online TPP Program

#Question id: 13100

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 21010

#Section 4: Fundamentals of Biological Engineering

During a batch culture experiment, the following data was obtained 

What will be the product yield (g) per gram of substrate?