TLS Online TPP Program

#Question id: 36248


Which of the following is/are correct about PAM Matrix ? 

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. Derived from an evolutionary model.
  2. Used for detecting Conserved protein domain.
  3. Global alignment method is used.
  4. This is also used for detecting Conserved domain.
More Questions
TLS Online TPP Program

#Question id: 13093

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are studying a specific gene in yeast, and you want to express that yeast gene in E. coli. Your task is to design a strategy to insert the yeast gene into the bacterial plasmid. Below is a map of the area of the yeast genome surrounding the gene in which you are interested.
 
The distance between each tick mark placed on the line above is 100 bases in length
Below are the enzymes you can use, with their specific cut sites shown 5’-XXXXXX-3’ 3’-XXXXXX-5’
 
The plasmid is 5,000 bases long and the two farthest restriction enzyme sites are 200 bases apart. The plasmid has an ampicillin resistance gene somewhere on the plasmid distal from the restriction cut sites.
                                    
You transform your ligation planned in which two restriction enzymes would you use to design a way to get the insert into the vector if you had to use two enzymes simultaneously, into bacteria and plate the bacteria on Petri plates containing ampicillin. (You actually transform six different ligation mixtures, which are described below, into six different populations of cells, and plate each transformation onto a different plate, because you want to do all of the correct controls.) The next day you come in to lab to look at how many colonies of bacteria are on each plate. You are really excited, because the number of colonies you see on each plate tells you that the entire procedure worked! Which of the three following patterns of number of colonies did you see in order to conclude that you had a successful transformation?
In this table, DV = digested vector. DYG = digested yeast genome.
 

TLS Online TPP Program

#Question id: 13094

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are studying a specific gene in yeast, and you want to express that yeast gene in E. coli. Your task is to design a strategy to insert the yeast gene into the bacterial plasmid. Below is a map of the area of the yeast genome surrounding the gene in which you are interested.
 
The distance between each tick mark placed on the line above is 100 bases in length
Below are the enzymes you can use, with their specific cut sites shown 5’-XXXXXX-3’ 3’-XXXXXX-5’
 
The plasmid is 5,000 bases long and the two farthest restriction enzyme sites are 200 bases apart. The plasmid has an ampicillin resistance gene somewhere on the plasmid distal from the restriction cut sites.
                                     
You transform your ligation planned in which two restriction enzymes would you use to design a way to get the insert into the vector if you had to use two enzymes simultaneously, into bacteria and plate the bacteria on Petri plates containing ampicillin. (You actually transform six different ligation mixtures, which are described below, into six different populations of cells, and plate each transformation onto a different plate, because you want to do all of the correct controls.) The next day you come in to lab to look at how many colonies of bacteria are on each plate. You are really excited, because the number of colonies you see on each plate tells you that the entire procedure worked! Which of the three following patterns of number of colonies did you see in order to conclude that you had a successful transformation?
In this table, DV = digested vector. DYG = digested yeast genome.
 
a) Pattern-1, DV only + Ligase→No colonies b/c you have digested with 2 different restriction enzymes that can’t ligate together 
b) Pattern-2, DYG only + Ligase→ No colonies because all you transformed is the digested, linear yeast DNA.
c) Pattern-3, Water + Ligase→ No plasmid with the ampicillin resistance gene (or any DNA) was transformed into the bacteria and so it won’t grow in the presence of ampicillin.
d)Pattern-3, DV + DYG + Ligase→Colonies. The plasmid and yeast gene can ligate together to form a functional plasmid that will express the ampicillin resistance gene.
e) Pattern-1 and 2 only, DV + DYG (No Ligase) →No colonies because, although you have both digested plasmid and a digested yeast gene with complementary sticky ends
Which of the following statements about these ligations and their pattern is correct?

TLS Online TPP Program

#Question id: 13095

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 13096

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 13097

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
If you take any bacterial gene sequence, before you begin doing any sequence analysis on it, there are six potential open reading frames. Why are there six?

TLS Online TPP Program

#Question id: 13098

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
How many of the 6 potential open reading frames are actually open in this sequence shown above?