Which of the following types of molecules are hydrophilic and therefore excluded from the hydrophobic portion of the phospholipid bilayer?

TLS Online TPP Program

#Question id: 13036

#SCPH05 I Biotechnology

In isoelectric focusing the protein will move until

TLS Online TPP Program

#Question id: 16095

#I Life Science/ Life Sciences Group – I-V

At which temperature does the excitation of the thermoreceptors begin to cause pain?

TLS Online TPP Program

#Question id: 4833

#SCPH12 I Genetics

If the percentage of chance of crossing over between two genes is10, then the distance between two genes will be

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 949

#SCPH28 | Zoology

Nitric oxide is produced from which reaction?