In plants, a growing mass of unorganized and undifferentiated cells that cover a wound; these cells can be induced to form a plant meristem and develop into shoots and/or roots called as

TLS Online TPP Program

#Question id: 938

#SCPH05 I Biotechnology

Physiological roles for glutamate dehydrogenase include all of the following, except

TLS Online TPP Program

#Question id: 3031

#I Life Science/ Life Sciences Group – I-V

In the growth equation: n = 3.3 (log10 N – log10 No), n stands for

TLS Online TPP Program

#Question id: 18660

#SCPH06 I Botany

In Gradient Gel system gel from 5 to 25 % is used, which created sieving effect due to this effect

TLS Online TPP Program

#Question id: 7316

#I Life Science/ Life Sciences Group – I-V

Programmed cell death, or apoptosis, is an essential part of animal development. In the nematode, with its invariant cell lineage, particular cell lineages or particular cells within specific lineages are destined to end in programmed cell death, and it was this feature that allowed the identification of the process and the analysis of its genetic control.

Which of the following combination of genes are correct?

TLS Online TPP Program

#Question id: 13096

#SCPH05 I Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?