TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 13104
#SCPH01 Biochemistry
With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.)
You do each PCR reaction and load each one into a separate well of an agarose gel, and then run the gel.
Why is it that some people show two bands?
TLS Online TPP Program
#Question id: 2959
#I Life Science/ Life Sciences Group – I-V
During which of the following mitotic phases are chromosomes dispersed the most?
TLS Online TPP Program
#Question id: 4730
#SCPH06 I Botany
Cross is made between a pure breeding plant having red coloured male flowers with a pure breeding plant having white colored female flowers. All of these offspring are white colored flower. Upon selfing of these F1 red flower plant produced both red and white flower. Which of the following is conclusion of these cross?
TLS Online TPP Program
#Question id: 13096
#SCPH28 | Zoology
You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program
#Question id: 4564
#I Life Science/ Life Sciences Group – I-V
Who would have proposed that the boundaries between each stratum mark the occurrence of different localized floods?