The existence of different pathways that serve a similar function and can replace each other without a clear loss in function is called,

TLS Online TPP Program

#Question id: 355

#SCPH05 I Biotechnology

Measurements show that the pH of a particular lake is 4.0. What is the hydroxide ion concentration of the lake?

TLS Online TPP Program

#Question id: 20711

#SCPH06 I Botany

During the electron transfer process, usable energy is recovered via a series of redox reactions through the formation of 

1. Energy storage compounds 

2. Electrochemical gradients

3. Vacoules

Which of the below combinations are correct?

TLS Online TPP Program

#Question id: 2615

#I Life Science/ Life Sciences Group – I-V

What are the effects shown in trp operon if we fused regulatory region of lac with structural genes of trp; which one is incorrect,

TLS Online TPP Program

#Question id: 5219

#SCPH06 I Botany

What is it that can be duplicated in a genome?

TLS Online TPP Program

#Question id: 13095

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.