Which of the following is most likely at the “J point” in an EKG of a patient with a damaged cardiac muscle?

TLS Online TPP Program

#Question id: 13101

#SCPH06 I Botany

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 18382

#SCPH05 I Biotechnology

Which bacterial enzyme has been transferred to Arabidopsis thaliana which can absorb mercury, and it reduces to volatile Hg from the leaf surface. 

TLS Online TPP Program

#Question id: 19670

#SCPH05 I Biotechnology

Ethers may be used as solvents because they react only with which of the following reactants?

TLS Online TPP Program

#Question id: 3875

#SCPH05 I Biotechnology

Splicing of introns in nuclear mRNA primary transcripts requires:

TLS Online TPP Program

#Question id: 10562

#I Life Science/ Life Sciences Group – I-V

The direction and rate of water flow across a membrane are determined by