Which antibiotics may be completely ineffective in treating a mycoplasmal infection?

TLS Online TPP Program

#Question id: 7299

#I Life Science/ Life Sciences Group – I-V

Maintenance of the shoot meristems in adult Arabidopsis plants relies on which of the following mechanisms?

TLS Online TPP Program

#Question id: 14281

#SCPH05 I Biotechnology

cells are grown in a CSTR a steady state at two dilution rates 0.1 h^-1 and 0.5h^-1 and the steady state concentrations are as follows: 

if the inlet substrate concentration is 20 g/I, the cells follow monod growth kinetics and product formation kinetics is modelled as a both growth associated and non growth associated kinetics given by the equation then answer the following questions, the best estimate of maximum specific growth rate is: 

TLS Online TPP Program

#Question id: 1774

#SCPH01 Biochemistry

hinge region  provide flexibility to antibody. Which amino acid is responsible for these flexibility?

TLS Online TPP Program

#Question id: 28018

#Research Methodology

Research can be classified as:

a) Basic, Applied and Action Research

b) Quantitative and Qualitative Research

c) Philosophical, Historical, Survey and Experimental Research

TLS Online TPP Program

#Question id: 13101

#SCPH28 | Zoology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?