Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 15698

#SCPH01 Biochemistry

Which of the following does not describe global alignment algorithm?

TLS Online TPP Program

#Question id: 15698

#I Life Science/ Life Sciences Group – I-V

Which of the following does not describe global alignment algorithm?

TLS Online TPP Program

#Question id: 15698

#SCPH05 I Biotechnology

Which of the following does not describe global alignment algorithm?

TLS Online TPP Program

#Question id: 15698

#SCPH05 I Biotechnology

Which of the following does not describe global alignment algorithm?

TLS Online TPP Program

#Question id: 15699

#SCPH01 Biochemistry

The PROSITE pattern representing the conserved sequence motif for a new family of AMP binding protein is [LIVMFY]-X(2)-[STG]-[STAG]-G-[ST]. You are given a sequence of a 15-amino acid stretch starting from the first residue of the motif. Which one of the following proteins is likely to have AMP binding function?

TLS Online TPP Program

#Question id: 15699

#I Life Science/ Life Sciences Group – I-V

The PROSITE pattern representing the conserved sequence motif for a new family of AMP binding protein is [LIVMFY]-X(2)-[STG]-[STAG]-G-[ST]. You are given a sequence of a 15-amino acid stretch starting from the first residue of the motif. Which one of the following proteins is likely to have AMP binding function?