Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14925

#SCPH05 I Biotechnology

Assuming the laminar flow across the filter, the rate of filtration (dVf/dt) can be expressed as a function of pressure drop tap, by the modified D'Arcy's equation as (where A is the area of filtering surface, K is the D'Arcy's filter cake permeability and L is the thickness of the filter cake) 

TLS Online TPP Program

#Question id: 19760

#SCPH05 I Biotechnology

Which of the following compound possesses covalent bond ?

TLS Online TPP Program

#Question id: 2651

#SCPH05 I Biotechnology

In the presence of lactose, how long does it take for the lac operon to be expressed?

TLS Online TPP Program

#Question id: 19340

#SCPH06 I Botany

Which one of the following is a bio-recognition element?

1. DNA

2. Enzyme

3. Antibody

4. Lipid

Which of the above options is incorrect?

TLS Online TPP Program

#Question id: 10690

#SCPH06 I Botany

Which of following interaction shown in following species of Paramecium?