The most electronegative element in the periodic table is———

TLS Online TPP Program

#Question id: 446

#SCPH05 I Biotechnology

Which statement is false about ATP?

TLS Online TPP Program

#Question id: 14333

#SCPH05 I Biotechnology

A cylindrical bioreactor of diameter 3 m has four baffles. A Rushton turbine mounted in the reactor has a diameter one third the tank diameter and is operated at a speed of 90 rpm. The density of the fluid is approximately I g cm^-3. The reactor is used to culture an anaerobic organism that does not require gas sparging. The broth can be assumed Newtonian. As the cells grow, the viscosity of the broth increases. when the viscosity is 1000 times greater than water, estimate the power required to achieve turbulence.

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 2606

#I Life Science/ Life Sciences Group – I-V

Activity of trp operon is taken as a measurement of ;

TLS Online TPP Program

#Question id: 8948

#SCPH06 I Botany

What distinguishes a coelomate animal from a pseudocoelomate animal is that coelomates