Following are certain statements are related to the effect of red and far-red light;

a) under a dense canopy much of the red light is absorbed by plant pigments, resulting in transmittance of mostly far-red light

b) Pr (red) has highest photon flux at 680 nm while Pfr (far-red) has highest photon flux at 730nm

c) Pfr far-red light–absorbing form, which is considered to be the physiologically active form of phytochrome

d) R:FR ratio is strongly affected by the presence of a canopy because chlorophyll absorbs far-red but not red light

Which one of the combinations of above statements is incorrect?

TLS Online TPP Program

#Question id: 18636

#SCPH01 Biochemistry

Number of rooted trees in a phylogeny of three sequences is –

TLS Online TPP Program

#Question id: 1686

#SCPH05 I Biotechnology

A hapten is best defined as being:

TLS Online TPP Program

#Question id: 10554

#SCPH05 I Biotechnology

Transpiration is an important means of dissipating the heat input from sunlight, Heat dissipates because the water molecules that escape into the atmosphere

TLS Online TPP Program

#Question id: 13095

#SCPH06 I Botany

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 14161

#I Life Science/ Life Sciences Group – I-V

Which of the following is not a description of dynamic programming algorithm?