TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#SCPH05 I Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 10252

#I Life Science/ Life Sciences Group – I-V

When molecular oxygen is unavailable—for example, in plant roots in flooded soils—glycolysis can be the main source of energy for cells, How?

TLS Online TPP Program

#Question id: 10252

#SCPH05 I Biotechnology

When molecular oxygen is unavailable—for example, in plant roots in flooded soils—glycolysis can be the main source of energy for cells, How?

TLS Online TPP Program

#Question id: 10253

#I Life Science/ Life Sciences Group – I-V

Two pathways for the splitting of sucrose are known in plants, both of which take part in the use of sucrose from phloem unloading;

TLS Online TPP Program

#Question id: 10253

#SCPH05 I Biotechnology

Two pathways for the splitting of sucrose are known in plants, both of which take part in the use of sucrose from phloem unloading;

TLS Online TPP Program

#Question id: 10254

#I Life Science/ Life Sciences Group – I-V

Sucrose is split into its two monosaccharide units—glucose and fructose—which can readily enter the glycolytic pathway. Two pathways for the splitting of sucrose are known in plants, both of which take part in the use of sucrose from phloem unloading; Invertase pathway and sucrose synthase pathway, some statements are given about these pathways, which of the following is incorrect?

TLS Online TPP Program

#Question id: 10254

#SCPH05 I Biotechnology

Sucrose is split into its two monosaccharide units—glucose and fructose—which can readily enter the glycolytic pathway. Two pathways for the splitting of sucrose are known in plants, both of which take part in the use of sucrose from phloem unloading; Invertase pathway and sucrose synthase pathway, some statements are given about these pathways, which of the following is incorrect?