Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 5532

#I Life Science/ Life Sciences Group – I-V

When does a human egg cell accomplish its meiotic division?

TLS Online TPP Program

#Question id: 2300

#I Life Science/ Life Sciences Group – I-V

Which of the following is not found in cell sap?

TLS Online TPP Program

#Question id: 5117

#SCPH01 Biochemistry

 The pathway from a gene to a protein in eukaryotic cells involves:

TLS Online TPP Program

#Question id: 10517

#SCPH05 I Biotechnology

plant–insect herbivore interactions releases three types of hormone including—

TLS Online TPP Program

#Question id: 4908

#SCPH28 | Zoology

Shell coiling of the snail is maternal effect phenotype control by S gene, where S Dextral is dominant over s sinistral. If snail sinistral coiled shell, which of the following statement is true