TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#SCPH05 I Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 12686

#SCPH06 I Botany

The two polynucleotide chains in DNA are usually found in the shape of_____

TLS Online TPP Program

#Question id: 12686

#SCPH28 | Zoology

The two polynucleotide chains in DNA are usually found in the shape of_____

TLS Online TPP Program

#Question id: 12702

#SCPH12 I Genetics

Some given characteristics features of Cytoplasmic inheritance, which of the following statements are not follow the inheritance pattern;
a) Cytoplasmic gene and their trait present in both male and female
b) Reciprocal cross results aren’t change
c) Exhibit extensive phenotypic variation
d) Reciprocal cross results are change
e) Mendel’s principle of segregation and independent assortment are follow

TLS Online TPP Program

#Question id: 12703

#SCPH12 I Genetics

In the plants, due to mutation in the mitochondrial genome causing cytoplasmic male sterility can be influenced by the nuclear gene (Rf),  which is dominant over the cytoplasmic mitochondrial genome. If a male sterile plant  is pollinated by the fertile male plant with homozygous (Rf)condition, the progeny obtained in F1 will have

TLS Online TPP Program

#Question id: 12704

#SCPH12 I Genetics

Cytoplasmic male sterility (CMS) in plants is caused by mutation in the mitochondrial genome. CMS can be restored by a nuclear gene, restorer of fertility (Rf), which is a dominant character. 

TLS Online TPP Program

#Question id: 12705

#SCPH12 I Genetics

In Neurospora crasssa, the mutant exhibit poky phenotype, when a female of  poky strain is crossed with a normal strain acting as a male , all progeny individuals shows poky phenotype . however, the reciprocal cross resulted in all normal progeny. These results can be explained on the basis of