Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 41492
TLS Online TPP Program

#Question id: 2677

Why is the transcription of structural genes of the trp operon turned off in the presence of tryptophan?

#SCPH05 I Biotechnology

  1. Tryptophan is the repressor that binds to the operator, preventing transcription.

  2. The structural genes are used to make tryptophan, which would not be needed if tryptophan is available.

  3. Tryptophan has no effect on the transcription of the structural genes.

  4. Tryptophan RNA polymerase from finding the promoter of the trp operon, preventing structural gene transcription.

More Questions
TLS Online TPP Program

#Question id: 5250

#I Life Science/ Life Sciences Group – I-V

A researcher would like to map the location of galE and trpA genes in a new species of bacterium that appears to be closely related to E. coli. He decides to use cotransduction, and generatesnappropriate donor and recipient strains. He is disappointed when cotransduction is not seen in his experiement. What is the most reasonable explanation for this situation?
TLS Online TPP Program

#Question id: 389

#SCPH05 I Biotechnology

A weak acid HA has a pKa of 5.0.  If 1.0 mol of this acid and 0.1 mol of NaOH were dissolved in one liter of water, what would the final pH be?
TLS Online TPP Program

#Question id: 16489

#SCPH01 Biochemistry

The beginning of animal tissue culture can be traced when Arnold showed that 
TLS Online TPP Program

#Question id: 10356

#I Life Science/ Life Sciences Group – I-V

Why the GS  and GOGAT is activated in light and while the AS is inhibited?
TLS Online TPP Program

#Question id: 13101

#SCPH28 | Zoology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?