Which of the following palindromes is not a restriction site?

TLS Online TPP Program

#Question id: 18764

#SCPH01 Biochemistry

which of the following statement is incorrect about loop modelling?

TLS Online TPP Program

#Question id: 11272

#SCPH28 | Zoology

Measurement of phytoplankton production, take sample of phytoplankton suspended in three bottles in lake. One bottle as control assumed as initial, second bottle (D) was kept in dark while third bottle (L) was kept in light. After some time productivity measure fallow

A- Difference in dissolved oxygen between light bottle and dark bottle yield NET primary productivity

B- Difference in dissolved oxygen between light bottle and initial bottle yield NET primary productivity

C- Difference in dissolved oxygen between light bottle and initial bottle yield Grass primary productivity

D- Difference in dissolved oxygen between light bottle and dark bottle yield total oxygen produced by photosynthesis

Which above combination of statement are correct?

TLS Online TPP Program

#Question id: 11922

#SCPH28 | Zoology

Which of the following environmental features might influence microclimates? 

TLS Online TPP Program

#Question id: 12686

#SCPH28 | Zoology

The two polynucleotide chains in DNA are usually found in the shape of_____

TLS Online TPP Program

#Question id: 13096

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?