TLS Online TPP Program

#Question id: 1673


N-region insertion is associated with the expression of:

#SCPH05 I Biotechnology
  1. Terminal deoxynucleotidyl transferase.

  2. NK cell antigen receptors

  3. The immunoproteasome

  4. Lysozyme

More Questions
TLS Online TPP Program

#Question id: 13096

#SCPH06 I Botany

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 27809

#Research Methodology

What is the primary goal of quantitative research?

TLS Online TPP Program

#Question id: 13058

#SCPH06 I Botany

Precision will be reduced, but yield will be increased
Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.
Which of the following true about real time PCR?

TLS Online TPP Program

#Question id: 23178

#SCPH06 I Botany

If cyan fluorescent protein (CFP) and yellow  fluorescent protein (YFP) are present in close proximity  and emission light of wavelength 433nm is applied what will be observed.

TLS Online TPP Program

#Question id: 768

#SCPH06 I Botany

MicroRNAs are important gene regulators, but the miRNAs are also regulated in turn by other RNAs. Which, if any, of the following classes of RNA are not known to contain RNAs that regulate miRNAs?