Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 41971
TLS Online TPP Program

#Question id: 15881

Protoplast is____

#SCPH05 I Biotechnology
  1. A plant cell without a cell wall
  2. A plant cell without organelles
  3. Another name for protoplasm
  4. A meristematic tissue
More Questions
TLS Online TPP Program

#Question id: 14770

#SCPH01 Biochemistry

Which of the following is a sequence alignment tool?
TLS Online TPP Program

#Question id: 11008

#I Life Science/ Life Sciences Group – I-V

Which of the following events is associated with the first heart sound?
TLS Online TPP Program

#Question id: 10536

#SCPH05 I Biotechnology

Hormonal interactions contribute to plant–insect herbivore interactions such as— ethylene, salicylic acid, and jasmonic acid. In particular, ethylene appears to play an important role in this context, what will be the effect of ethylene when is applied alone and when is applied with other amino acids?

a) ethylene applied together with JA it seems to reduces defense responses

b) Ethylene appears to applied alone to plants, ethylene has little effect on defense-related gene activation

c) when ethylene applied together with JA it seems to enhance JA responses or defense responses are significantly increased

d) Ethylene appears to applied alone to plants, ethylene has more effect on defense-related gene activation

Which of the following combination is correct about ethylene effects?
TLS Online TPP Program

#Question id: 13096

#SCPH06 I Botany

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program

#Question id: 1561

#SCPH01 Biochemistry

The cells and signaling molecules involved in the initial stages of the inflammatory response are ?