Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 42876
TLS Online TPP Program

#Question id: 14283

Aeration ina fermenter is expressed as VVM. What will be the VVM if air is sparged at 2000 L/min with a working volume 10 m^3? 

#SCPH05 I Biotechnology
  1. 0.2
  2. 0.5
  3. 1
  4. 1.2 
More Questions
TLS Online TPP Program

#Question id: 6944

#SCPH01 Biochemistry

Which would lead to a dorsalized embryo? (Recall that genes in Drosophila are named for their mutant phenotype.
TLS Online TPP Program

#Question id: 3916

#SCPH28 | Zoology

Transcription termination
TLS Online TPP Program

#Question id: 14523

#SCPH01 Biochemistry

A man takes a step forward with probability 0.4 and backward with probability 0.6. The probability that at the end of eleven steps he is one step away from the starting point.
TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 10887

#SCPH06 I Botany

What is a linkage density of community A and B RESPECTIVELY?