You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

#Question id: 4959

#SCPH28 | Zoology

If a fossil is encased in a stratum of sedimentary rock without any strata of igneous rock (e.g., lava, volcanic ash) nearby, then it should be

#Question id: 4960

#SCPH06 I Botany

Letʹs say that a hypothetical submersible robot was used to collect samples of sedimentary rock from the sea floor along the section illustrated. The robot moved back and forth along the transect, collecting first from site A, then site III, then site B, then site II, and lastly site D. Assuming that sedimentation has occurred at a constant rate along the transect over the past million years, rearrange the sites mentioned above on the basis of the thickness of the sediments overlying the igneous rock, from thickest to thinnest.

#Question id: 4960

#SCPH28 | Zoology

Letʹs say that a hypothetical submersible robot was used to collect samples of sedimentary rock from the sea floor along the section illustrated. The robot moved back and forth along the transect, collecting first from site A, then site III, then site B, then site II, and lastly site D. Assuming that sedimentation has occurred at a constant rate along the transect over the past million years, rearrange the sites mentioned above on the basis of the thickness of the sediments overlying the igneous rock, from thickest to thinnest.

#Question id: 4961

#SCPH06 I Botany

An early consequence of the release of oxygen gas by plant and bacterial photosynthesis was to

#Question id: 4961

#SCPH28 | Zoology

An early consequence of the release of oxygen gas by plant and bacterial photosynthesis was to

#Question id: 4963

#SCPH06 I Botany

Which free-living cells were the earliest contributors to the formation of Earthʹs oxidizing atmosphere?