Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 15872

#SCPH05 I Biotechnology

For optimum callus growth, the given some following vitamins are required, except;

TLS Online TPP Program

#Question id: 435

#SCPH06 I Botany

What defines a near-equilibrium reaction?

TLS Online TPP Program

#Question id: 12371

#SCPH28 | Zoology

Succession results from disturbance by fire.

TLS Online TPP Program

#Question id: 15235

#SCPH01 Biochemistry

During the casting of polyacrylamide gel acrylamide and bis-acrylamide are joined by 

A) Free radical catalysis

B) Polymerisation reaction

C) Dehydration reaction

D) Condensation reaction

TLS Online TPP Program

#Question id: 1296

#SCPH28 | Zoology

People with a defect in the synthesis of the integrin β2 subunit exhibit reduced: