Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 43188
TLS Online TPP Program

#Question id: 15885

In batch fermentation___

#SCPH05 I Biotechnology
  1. Substrates are added to the system all at once and runs until product is harvested
  2. Nutrient are continuously fed into the reactor and the product is siphoned off during the run
  3. New batches of microorganisms are screened for increase yield
  4. Small-scale production is used to synthesize product
More Questions
TLS Online TPP Program

#Question id: 13100

#SCPH01 Biochemistry

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?
TLS Online TPP Program

#Question id: 2128

#SCPH28 | Zoology

The fluidity of a lipid bilayer will be increased by:
TLS Online TPP Program

#Question id: 9190

#SCPH28 | Zoology

What is the probable role of salicylic acid in the defense responses of plants?
TLS Online TPP Program

#Question id: 1701

#I Life Science/ Life Sciences Group – I-V

Which of the following statements is TRUE of superantigens?
TLS Online TPP Program

#Question id: 2940

#SCPH01 Biochemistry

Chk1is activated by: