Practice Questions

TLS Online TPP Program

#Question id: 27188

k for a zero order reaction is 2×10^-2 mol/L s. If the concentration of the reactant after 25s is 0.5 M. Calculate the initial concentration of the reactant.

#SCPH05 I Biotechnology

More Questions

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#SCPH01 Biochemistry

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14119

#I Life Science/ Life Sciences Group – I-V

Which of the following is incorrect regarding sequence homology?

Triyambak Life Sciences
Nurturing Life Sciences

TLS Online
Nurturing Life Sciences

k for a zero order reaction is 2×10^-2 mol/L s. If the concentration of the reactant after 25s is 0.5 M. Calculate the initial concentration of the reactant.

Practice Questions

k for a zero order reaction is 2×10-2 mol/L s. If the concentration of the reactant after 25s is 0.5 M. Calculate the initial concentration of the reactant.

k for a zero order reaction is 2×10^-2 mol/L s. If the concentration of the reactant after 25s is 0.5 M. Calculate the initial concentration of the reactant.