Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 43484
TLS Online TPP Program

#Question id: 5130

Regulation by gradients of paracrine factor concentration was elegantly demonstrated by the specification of different mesodermal cell types in the frog Xenopus laevis by activin, a paracrine factor of the TGF-beta family. Which of the following observations are correct from this graph?


#SCPH01 Biochemistry

  1. High concentrations of activin activate goosecoid, whereas lower concentrations activate Xbra.

  2. Lower concentrations of activin activates only goosecoid not Xbra.

  3. This pattern not correlates with the number of activin receptors occupied on individual cells.

  4. In presence of activin neither the goosecoid nor the Xbra are activated

More Questions
TLS Online TPP Program

#Question id: 14782

#SCPH06 I Botany

x is a random variable with mean    
TLS Online TPP Program

#Question id: 92

#SCPH01 Biochemistry

Monosaccharide derivatives in which an amino group replaces one of the hydroxyl groups may have important roles in
TLS Online TPP Program

#Question id: 3623

#SCPH06 I Botany

To carry out a complementation test, which of the following statement is correct?
TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 1583

#SCPH28 | Zoology

These cells are involved in cell-mediated immunity and destroy virally infected cells: