if mendal had studied the seven trait using a plant with 12 chromosome instead of 14, in what manner would his interpretation have been different ?

TLS Online TPP Program

#Question id: 7311

#SCPH06 I Botany

According to the ABC model of flower development in Arabidopsis, three classes of organ identity genes— designated A, B, and C— are required to specify the identity of floral organs in each whorl of a flower. If wild type Arabidopsis were transformed with a chimeric gene composed of a C class promoter fused to a B class coding sequence, which of the following arrangements   (outer to inner) would be predicted?

TLS Online TPP Program

#Question id: 27791

#Research Methodology

Real facts can be observed in _________.

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 12934

#I Life Science/ Life Sciences Group – I-V

Reverse transcriptase enzyme is isolated from____

TLS Online TPP Program

#Question id: 4810

#SCPH28 | Zoology

In a haploid organism, the C and D loci are 8 m.u. apart. From a cross C d X c D, which of the following proportion following progeny classes: (a) C D; (b) c d; (c) C d