Multiple alleles control inheritance of

TLS Online TPP Program

#Question id: 13101

#SCPH06 I Botany

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 5040

#SCPH06 I Botany

 The establishment of the anterior-posterior or dorsal-ventral body axes is called:

TLS Online TPP Program

#Question id: 18382

#I Life Science/ Life Sciences Group – I-V

Which bacterial enzyme has been transferred to Arabidopsis thaliana which can absorb mercury, and it reduces to volatile Hg from the leaf surface. 

TLS Online TPP Program

#Question id: 450

#SCPH06 I Botany

The DG'° values for the two reactions shown below are given.

Oxaloacetate + acetyl-CoA + H2O -> citrate + CoASH DG'° = –32.2 kJ/mol

Oxaloacetate + acetate    ->   citrate DG'° = –1.9 kJ/mol

What is the DG'° for the hydrolysis of acetyl-CoA?

Acetyl-CoA + H2O -> acetate + CoASH + H+

TLS Online TPP Program

#Question id: 9164

#SCPH06 I Botany

Use the following figures to answer the question below.

East of the Mississippi River, in Hopkinsville Kentucky, the mean annual precipitation is 130 cm. The mean annual temperature is 14.3°C. In the winter, the mean temperature is 7.3°C, while in summer it is 20.6°C. Using the climograph shown here, how would we classify the biome found in Hopkinsville?