The fundamental notion of a stem cell is that it can make more stem cells while also producing cells committed to undergoing differentiation. This process is called as-

TLS Online TPP Program

#Question id: 3902

#SCPH28 | Zoology

Which of the following is/are incorrect?

TLS Online TPP Program

#Question id: 19367

#SCPH28 | Zoology

First phase genetic engineering is done for production of 

1. Human growth hormone

2. Insulin 

3. Interferon

Which of the above products are correct?

TLS Online TPP Program

#Question id: 13096

#SCPH06 I Botany

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 293

#I Life Science/ Life Sciences Group – I-V

Which of the following types of bonds or interactions between lipid hydrocarbon tails is responsible for lipids forming a membrane bilayer or membranous vesicles in water

TLS Online TPP Program

#Question id: 4731

#SCPH01 Biochemistry

A pure-breeding strain of squash that produced disk-shaped fruits was crossed with a pure breeding strain having long fruits. The F1 had disk fruits, but the F2 showed a new phenotype, sphere, and was composed of the following proportions

Disk  384            

Sphere 96

 Long  32

What is reason for F2 phenotype?