TLS Online TPP Program

#Question id: 10348


During ammonium assimilation, requires two enzymes converting ammonium to amino acids. Each of which is Glutamine synthetase (GS), given below some statements about GS ;

a) GS transfers the amide group of glutamine to 2-oxoglutarate, yielding two molecules of glutamate

b) it requires a divalent cation such as Mg2+, Mn2+, or Co2+ as a cofactor

c) Plants contain two classes of GS, one in the cytosol and the other in root plastids or shoot chloroplasts

d) The cytosolic forms are expressed in germinating seeds or in the vascular bundles of roots and shoots and produce glutamate for intercellular nitrogen transport

e) The GS in root plastids generates amide nitrogen for local consumption; the GS in shoot chloroplasts reassimilates photorespiratory NH4+

f) Light and carbohydrate levels alter the expression of the cytosolic forms of the enzyme, but they have little effect on the plastid forms.

Which of the following statements is correct?

#SCPH06 I Botany
  1. a, d and f
  2. c, d and e
  3. a, b and f
  4. b, c and e
More Questions
TLS Online TPP Program

#Question id: 10387

#I Life Science/ Life Sciences Group – I-V

Action spectrum stimulated phototropism in oat coleoptiles. The “three finger” pattern in the 400–500 nm region is characteristic of-

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 3651

#SCPH28 | Zoology

__________________is spontaneous hydrolytic reaction that involves cleavage of the N-glycosylic bond between N-9 of the purine bases A and G and C-1 of the deoxyribose sugar and hence loss of purine bases from the DNA.

TLS Online TPP Program

#Question id: 9210

#SCPH06 I Botany

Overharvesting encourages extinction and is most likely to affect ________.

TLS Online TPP Program

#Question id: 13058

#SCPH05 I Biotechnology

Precision will be reduced, but yield will be increased
Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.
Which of the following true about real time PCR?