TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 10387
#I Life Science/ Life Sciences Group – I-V
Action spectrum stimulated phototropism in oat coleoptiles. The “three finger” pattern in the 400–500 nm region is characteristic of-
TLS Online TPP Program
#Question id: 14118
#SCPH05 I Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 3651
#SCPH28 | Zoology
__________________is spontaneous hydrolytic reaction that involves cleavage of the N-glycosylic bond between N-9 of the purine bases A and G and C-1 of the deoxyribose sugar and hence loss of purine bases from the DNA.
TLS Online TPP Program
#Question id: 9210
#SCPH06 I Botany
Overharvesting encourages extinction and is most likely to affect ________.
TLS Online TPP Program
#Question id: 13058
#SCPH05 I Biotechnology
Precision will be reduced, but yield will be increased
Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.
Which of the following true about real time PCR?