Changement  in the physiology or morphology of the individual is a nonpermanent  or  temporary and that can be reversed if the prevailing environmental conditions change is termed as 

TLS Online TPP Program

#Question id: 5038

#SCPH06 I Botany

The folding of sheets of cells, the migration of cells, and cell death are all mechanisms of

TLS Online TPP Program

#Question id: 2314

#SCPH28 | Zoology

Mitochondria are inherited from.

TLS Online TPP Program

#Question id: 15218

#SCPH01 Biochemistry

Which technique is shown in given representation

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 16009

#SCPH05 I Biotechnology

BLAST uses a ______ to find matching words, whereas FASTA identifies identical matching words using the ______.