Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 45729
TLS Online TPP Program

#Question id: 5233

The most important feature that permits a gene to act as a molecular clock is ________.

#SCPH06 I Botany

  1. a large number of base pairs

  2. being acted upon by natural selection

  3.  a reliable average rate of mutation

  4. a recent origin by a gene-duplication event

More Questions
TLS Online TPP Program

#Question id: 14509

#SCPH01 Biochemistry

Aishwarya studies either computer science or mathematics everyday. If she studies computer science on a day, then the probability that she studies mathematics the next day is 0.6. If she studies mathematics on a day, then the probability that she studies computer science the next day is 0.4. Given that Aishwarya studies computer science on Monday, what is the probability that she studies computer science on Wednesday ?
TLS Online TPP Program

#Question id: 13101

#SCPH28 | Zoology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?
TLS Online TPP Program

#Question id: 10275

#SCPH05 I Biotechnology

In the initial phase of glycolysis, each hexose unit is phosphorylated twice and then split, producing two molecules of triose phosphate, in these reactions included irreversible reaction. How much irreversible reaction is performed in the glycolytic pathway through in this series of reactions?
TLS Online TPP Program

#Question id: 10524

#SCPH06 I Botany

Members of the Poaceae family, which includes all of the cereal crops, use benzoxazinoids, these alkaloids shows;

a) Alkaloids are derived from the tryptophan as constitutively produced defensive secondary metabolites

b) These benzoxazinoids such as DIBOA and its derivative DIMBOA are usually stored in the peroxisome

c) Upon damage, the inactive glycosides are hydrolyzed, generating glucosinolate, which are toxic not only to insect herbivores but also against pathogens

d) DIBOA and DIMBOA perform insecticidal and pesticidal activities

e) It can be inactivated by hydroxylation and N-glycosylation reactions

Which of the following combination is correct about benzoxazinoids alkaloids?
TLS Online TPP Program

#Question id: 4344

#SCPH01 Biochemistry

How does the transcription of structural genes in an inducible operon occur?