Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 45967
TLS Online TPP Program

#Question id: 9198

Tropical forests are being converted to farm or pasture land at an alarming rate, and one major focus is on the biodiversity and the impact to these ecosystems. What is a direct benefit to humans that helps explain why these forests need to be preserved?

#SCPH06 I Botany
  1.  This diversity provides areas for coffee growing.
  2. Natural and undisturbed areas are important wildlife habitats.
  3. The diversity could contain novel drugs for consumers.
  4. The plant diversity provides shade, which lowers global warming.
More Questions
TLS Online TPP Program

#Question id: 14117

#I Life Science/ Life Sciences Group – I-V

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14117

#SCPH05 I Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping
TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG