Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 46010
TLS Online TPP Program

#Question id: 9238

Which of the following is a consequence of biological magnification?

#SCPH06 I Botany

  1. Toxic chemicals in the environment pose greater risk to top-level predators than to primary consumers.

  2. Populations of top-level predators are generally smaller than populations of primary consumers.

  3. Only a small portion of the energy captured by producers is transferred to consumers.

  4. The amount of biomass in the producer level of an ecosystem decreases if the producer turnover time increases

More Questions
TLS Online TPP Program

#Question id: 2608

#SCPH05 I Biotechnology

Which amino acid is involved in last step;
TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 5716

#SCPH28 | Zoology

Which of the meiotic pairing possibilities in tetraploids and their consequence is correct?

A-chromosomes pair as bivalents, segregate normally producing diploid gametes.

B- Chromosomes pair as quadrivalent, segregates normally producing tetraploid gametes.

C-Chromosome pair as Trivalents form, segregation leads to nonfunctional aneuploid gametes

 D- Chromosome pair as Trivalents form, segregation leads to producing diploid gametes
TLS Online TPP Program

#Question id: 3469

#SCPH28 | Zoology

Individual A is cousin of B individual? During altruistic act A individuals get benefitted from B individual is 80. What is at least value of cost scarified by individuals A?
TLS Online TPP Program

#Question id: 14120

#SCPH01 Biochemistry

Which of the following is not a variant of BLAST?