Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 46012
TLS Online TPP Program

#Question id: 9239

Why are changes in the global carbon cycle important?

#SCPH06 I Botany
  1. Burning increases available carbon for primary producers and, therefore, primary consumers.
  2. Deforestation and suburbanization increase an area's net primary productivity.
  3. Increasing atmospheric concentrations of carbon dioxide are altering Earth's climate.
  4. By using fossil fuels, we are replenishing a nonrenewable resource.
More Questions
TLS Online TPP Program

#Question id: 10539

#SCPH05 I Biotechnology

All plants releases green-leaf volatiles in response to mechanical damage, this volatile is a mixture of
TLS Online TPP Program

#Question id: 13100

#SCPH06 I Botany

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?
TLS Online TPP Program

#Question id: 3261

#SCPH06 I Botany

A parent population (P) is change into daughter populations (Q) which grow in habitats. After 1000 generations, the equilibrium frequency distribution of of the daughter populations is shown in the figure below. For reference, the vertical line represents the mean of the parent population. Which type of natural selection?
TLS Online TPP Program

#Question id: 5134

#SCPH01 Biochemistry

Match the following cleavage patterns with the species in which they occur.

        Species                                           Cleavage Pattern

      A. Flatworm                                       i. Meroblastic discoidal

      B. Frog                                               ii. Meroblastic superficial

      C. Birds                                              iii. Holoblastic displaced radial

      D. Insect                                              iv. Holoblastic spiral
TLS Online TPP Program

#Question id: 19024

#SCPH01 Biochemistry

Computational tools that are used for the alignment of multiple sequences-