TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 15620
#SCPH06 I Botany
Wild type E. coli metabolizes the sugar lactose by expressing the enzyme ß-galactosidase. You have isolated a mutant that you call lac1–, which cannot synthesize ß-galactosidase and cannot grow on lactose (Lac–). During an condition Lac– strain, called lac3–, is linked to the Tn5 insertion. From a strain carrying the Tn5 insertion and lac3– mutation you isolate an F’ that caries a region of the chromosome that includes both Tn5 and the linked Lac region. Introduce this F’ into an F– strain carrying lac1– by selecting for Kanr. These merodiploids express ß-galactosidase normally. What does this result tell you about the relationship between the lac3– and lac1- mutations?
TLS Online TPP Program
#Question id: 366
#SCPH05 I Biotechnology
What is the pH of a solution with a hydroxyl ion (OH-) concentration of 10-10 M?
TLS Online TPP Program
#Question id: 11988
#SCPH28 | Zoology
If mayflies lay eggs on roads instead of in water, this behavior could involve which of the following?
TLS Online TPP Program
#Question id: 13096
#SCPH06 I Botany
You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program
#Question id: 10389
#I Life Science/ Life Sciences Group – I-V
The amount of light absorb by the plant per square meter (µmol m–2) known as