You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

#Question id: 2617

#I Life Science/ Life Sciences Group – I-V

According role of regulatory proteins, RNA polymerase and one or more promoter elements, mostly three levels of transcription are there, choose correct one

#Question id: 2965

#I Life Science/ Life Sciences Group – I-V

In a diploid cell with 5 chromosome pairs (2n = 10), how many centromeres will be found in a nucleus at G2 of the cell division cycle?

#Question id: 3479

#SCPH28 | Zoology

Which of the following could be classified as habituation?

A) You enter a room and hear a fan motor. After a period of time, you are no longer aware of the motorʹs noise.

B) You hear a horn while driving your car. You step on the brakes but notice the sound came from a side street. You resume your previous speed.

C) One morning you awake to a beep-beep-beep from a garbage truck working on a new early morning schedule. The next week the garbage truck arrives at the same time and makes the same noise, but does not wake you up.

#Question id: 15214

#SCPH28 | Zoology

#Question id: 10286

#SCPH05 I Biotechnology

The enzyme aldolase, catalyzes a reversible aldol condensation, Fructose 1,6-bisphosphate is cleaved to yield two different triose phosphates, glyceraldehyde 3-phosphate, an aldose, and dihydroxyacetone phosphate, a ketose. There are two classes of aldolases such as;

A) Class I aldolases

B) Class II aldolases

i) Found in animals and plants

ii) Found in in fungi and bacteria

iii) formation of protonated Schiff base on enzyme and its active site contain lysine residue

iv) do not form the Schiff base intermediate and a zinc ion at the active site is coordinated with the carbonyl oxygen at C-2

In which of the following option is the given enzyme with its correct statements?