A bag contains 8 green and 10 white balls. Two balls are drawn. What is the probability that one is green and the other is white ?

TLS Online TPP Program

#Question id: 3519

#SCPH01 Biochemistry

If quadruple heterozygote of genotype Aa Bb Cc Dd is self-fertilized, what is the probability of a quadruple heterozygote Aa Bb Cc Dd offspring is assuming independent assortment of all four pairs of alleles.

TLS Online TPP Program

#Question id: 11194

#I Life Science/ Life Sciences Group – I-V

The "threshold" potential of a membrane is the ________.

TLS Online TPP Program

#Question id: 4954

#SCPH28 | Zoology

If natural selection in a particular environment favored genetic systems that permitted the production of daughter ʺcellsʺ that were genetically dissimilar from the mother ʺcells,ʺ then one should expect selection for

I. polynucleotide polymerase with low mismatch error rates.

II. polynucleotide polymerases without proofreading capability.

III. batteries of efficient polynucleotide repair enzymes.

IV. polynucleotide polymerases with proofreading capability.

V. polynucleotide polymerases with high mismatch error rates.

TLS Online TPP Program

#Question id: 13100

#SCPH01 Biochemistry

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 18597

#SCPH28 | Zoology

Rapid development of the flowering plant appeared in which geological era?