Shell coiling in snail is determined by genetic maternal effect for a single loci having D allele for dextral coiling but S allele for sinistral coiling. D dominant over S. which of the following cross would produced all progeny that is dextral coiling ?

I- DD Male X SS female

II- DD Male X DS female

III- SS Male X DD female

IV - DS Male X DS female

TLS Online TPP Program

#Question id: 19516

#SCPH05 I Biotechnology

Which of the following does not belong in the category of electrochemical cells?

TLS Online TPP Program

#Question id: 13096

#SCPH05 I Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 7305

#SCPH01 Biochemistry

In plants, a growing mass of unorganized and undifferentiated cells that cover a wound; these cells can be induced to form a plant meristem and develop into shoots and/or roots called as

TLS Online TPP Program

#Question id: 13106

#SCPH01 Biochemistry

With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.) 

You do each PCR reaction on chromosome 15 and load each one into a separate well of an agarose gel, and then run the gel.

 

 

Why is it that some people only have one band?

TLS Online TPP Program

#Question id: 11008

#I Life Science/ Life Sciences Group – I-V

Which of the following events is associated with the first heart sound?