Both leading and lagging strand primers are elongated by:

TLS Online TPP Program

#Question id: 3887

#SCPH06 I Botany

Aptamers are

TLS Online TPP Program

#Question id: 941

#SCPH05 I Biotechnology

Which of the following is an amide-containing amino acid?

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14966

#I Life Science/ Life Sciences Group – I-V

The bacterial cell wall is composed of a macromolecular network called peplidoglycan (also known as murein) which is present either alone or in combination with other substances

TLS Online TPP Program

#Question id: 11798

#SCPH05 I Biotechnology

Companion cells transport of photosynthetic products from producing cells in mature leaves to the sieve elements in the minor veins of the leaf. There are at least three different types of companion cells in the minor veins of mature, exporting leaves, All three cell types have dense cytoplasm and abundant mitochondria;