Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 47692
TLS Online TPP Program

#Question id: 4345

For a repressible operon to be transcribed, which of the following conditions must occur?

#SCPH28 | Zoology

  1. A corepressor must be present.

  2. RNA polymerase and the active repressor must be present.

  3. RNA polymerase must bind to the promoter, and the repressor must be inactive.

  4. RNA polymerase must not occupy the promoter, and the repressor must be inactive.

More Questions
TLS Online TPP Program

#Question id: 7295

#SCPH28 | Zoology

If a long-day plant has a critical night length of 9 hours, which 24-hour cycle would prevent flowering? (SS)
TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 3509

#SCPH01 Biochemistry

Principle of independent assortment apply for those gene that is
TLS Online TPP Program

#Question id: 1738

#SCPH01 Biochemistry

T-cell help for antibody production:
TLS Online TPP Program

#Question id: 11605

#I Life Science/ Life Sciences Group – I-V

Major uses of gibberellins applied as a spray or dip, are to manage several processes except,