Cytotoxin T cells express

TLS Online TPP Program

#Question id: 19504

#SCPH05 I Biotechnology

The vertical columns in the periodic table are termed as ———-.

TLS Online TPP Program

#Question id: 1027

#SCPH28 | Zoology

Which of the following bacteria lack a cell wall?

TLS Online TPP Program

#Question id: 13100

#SCPH06 I Botany

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 281

#SCPH12 I Genetics

Histones associate with DNA primarily through ________.

TLS Online TPP Program

#Question id: 5136

#SCPH01 Biochemistry

Some statements regarding to hippo pathway.

A. The Hippo signal transduction pathway have a dedicated ligand or receptor

B. Hippo stands for one of several important kinases that are critical for organ size control

C. It was first identified in Drosophila, where its loss resulted in a “hippopotamus”-shaped phenotype due to excessive growth

D. Gain of Hippo causes cells to divide significantly faster while slowing apoptosis

E. overexpression of its main transcriptional effector, Yorkie causes cells to divide significantly faster while slowing apoptosis

Which of the following combination are incorrect?