The segmented blocks of tissue that develop on each side of the notochord are called the

TLS Online TPP Program

#Question id: 3859

#SCPH06 I Botany

Polyadenylation is:

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 23249

#SCPH28 | Zoology

Which enzyme converts the PPi to ATP in Pyrosequencing?

TLS Online TPP Program

#Question id: 27709

#Research Methodology

Social Science try to explain …………. Between human activities and natural laws governing them

TLS Online TPP Program

#Question id: 4156

#SCPH05 I Biotechnology

The reading frame of DNA is fixed by