Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 48263
TLS Online TPP Program

#Question id: 5544

Which embryonic membrane forms the commonly of the placenta?

#SCPH28 | Zoology

  1. Allantois

  2. Amnion

  3. Chorion

  4. Endometrium

More Questions
TLS Online TPP Program

#Question id: 8295

#SCPH05 I Biotechnology

Imagine that a phylogeny was developed for a group of mammals based on bone structure. Which of the following statements would be a reasonable prediction about a phylogeny for the same group of species based on similarities and differences in the structure of a particular enzyme?
TLS Online TPP Program

#Question id: 3434

#SCPH28 | Zoology

type of learning that can occur only during a brief period of early life and results in a behavior that is difficult to modify through later experiences is called
TLS Online TPP Program

#Question id: 3526

#SCPH01 Biochemistry

In garden peas, the allele for tall plants (D) is completely dominant to the allele for dwarf plants (d) and the allele for violet flower color (W) is completely dominant to the allele for white flower color (w). In a cross between a tall violet plant, with the genotype DDWw, and a dwarf white plant, what phenotypic ratio of the progeny would be expected from this cross?
TLS Online TPP Program

#Question id: 13101

#SCPH01 Biochemistry

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?
TLS Online TPP Program

#Question id: 10337

#SCPH06 I Botany

In biological nitrogen fixation, the process of nitrification by organism respective bacteria A--which convert the ammonia to nitrite and B--- further converted into nitrate in the soil by their respective A and B bacteria known as;