In autophagy, the endoplasmic reticulum (ER) first gives rise to a cup-shaped, membranous cisterna called the

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14768

#SCPH05 I Biotechnology

The information retrieval tool of NCBI GenBank is

TLS Online TPP Program

#Question id: 2306

#SCPH01 Biochemistry

The cells of the Eukarya can grow larger than the cells of the Bacteria or the Archaea because:

TLS Online TPP Program

#Question id: 27825

#Research Methodology

When conducting a survey in quantitative research, what is the typical format of the questions?

TLS Online TPP Program

#Question id: 18372

#SCPH28 | Zoology

Which enzyme is used to degrade of chlorinated solvents and pesticides present in soil makes the soil contaminated