Which of the following statements is not true for Hfr strains of E. coli ?

TLS Online TPP Program

#Question id: 12714

#SCPH06 I Botany

Physiological and biochemical perturbations in plants caused by fluctuations in the abiotic environment, given column I with environmental factor and with its effects in the form of primary effects  in column II and secondary effects  in column III

COLUMN I        (environmental factor )	COLUMN II            (primary effects)	COLUMN III         (secondary effects)
A) Water deficit	i) Hypoxia,  Anoxia	a) Membrane dysfunction
B) High temperature	ii) ROS production	b) Reduced cellular and metabolic activities, Leaf abscission, Ion cytotoxicity and Cavitation
C) Trace element toxicity	iii) Photo inhibition	c) Reduced respiration,     Fermentative metabolism,       Inadequate ATP production ,  ROS production and  Stomatal closure
D) Flooding and soil compaction	iv) Membrane destabilization	d) Inhibition of PSII repair
E) Chilling	v) Cell dehydration and Hydraulic resistance	e) Disruption of metabolism
F) High light intensity		f) Photosynthetic and respiratory inhibition, ROS production

Find out the correct combination of given above column;

TLS Online TPP Program

#Question id: 11449

#SCPH28 | Zoology

Artificial electrical stimulation of a human's menthol-sensitive neurons would likely produce the sensation of ________.

TLS Online TPP Program

#Question id: 1698

#SCPH05 I Biotechnology

An example of a “non-classical” MHC molecule is:

TLS Online TPP Program

#Question id: 305

#SCPH28 | Zoology

Conditions for ionic bond formation is / are________

(A) Small cation, large anion

(B) Low IP of cation, high electron affinity of anion

(C) Large cation, small anion and less charge

(D) Less lattice energy

Correct answer is:

TLS Online TPP Program

#Question id: 13101

#SCPH28 | Zoology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?