During the rate of succession several factors would be observe at the pioneer as well as climax community;

Match the community stages with its given characters;

TLS Online TPP Program

#Question id: 3665

#SCPH28 | Zoology

Which of the following is true for Tandem-duplication mutations?

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 10525

#I Life Science/ Life Sciences Group – I-V

The major cyanogenic glycoside in_____i______ is _____ii______.

a) i-sorghum, ii-Amygdalin

b) i-sorghum, ii-dhurrin

c) i-Cassava, ii-lotaustralin

d) i-Cassava, ii-linamarin

Which one is incorrect combination of cyanogenic glycoside?

TLS Online TPP Program

#Question id: 4141

#SCPH01 Biochemistry

Bacterial ribosomes:

TLS Online TPP Program

#Question id: 5262

#SCPH28 | Zoology

Which of the following characteristics is not true of a plasmid?