Which of the following biomes spans the largest annual mean temperature range, but the narrowest mean precipitation range?

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#SCPH01 Biochemistry

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14119

#I Life Science/ Life Sciences Group – I-V

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14119

#SCPH05 I Biotechnology

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14119

#SCPH05 I Biotechnology

Which of the following is incorrect regarding sequence homology?