TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 13047
#SCPH06 I Botany
8-Azaguanine renders the myeloma cells
TLS Online TPP Program
#Question id: 666
#I Life Science/ Life Sciences Group – I-V
Nearly all peptide bonds are in the trans configuration because
TLS Online TPP Program
#Question id: 2072
#I Life Science/ Life Sciences Group – I-V
Which of the following structures would decrease the electrochemical gradient across a membrane?
TLS Online TPP Program
#Question id: 14118
#SCPH05 I Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 556
#SCPH06 I Botany
Which of the following statement is correct to calculate the turnover number of an enzyme,
A) the enzyme concentration.
B) the initial velocity of the catalyzed reaction at [S] >> Km.
C) the initial velocity of the catalyzed reaction at low [S].
D) the Km for the substrate.