If the equilibrium constant, Keq, for the reaction ATP → ADP + Pi is 2.22 × 105 M, calculate the standard free-energy change, ΔG°, for the synthesis of ATP from ADP and Pi at 25 °C. -triyambak.org

Practice Questions

TLS Online TPP Program

#Question id: 51

If the equilibrium constant, Keq, for the reaction ATP → ADP + Pi is 2.22 × 10⁵ M, calculate the standard free-energy change, ΔG°, for the synthesis of ATP from ADP and Pi at 25 °C.

#SCPH01 Biochemistry

−30.5 kJ/mol
30.5 kJ/mol
−16.5 kJ/mol
45.5 kJ/mol

More Questions

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#SCPH01 Biochemistry

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14119

#I Life Science/ Life Sciences Group – I-V

Which of the following is incorrect regarding sequence homology?

Triyambak Life Sciences
Nurturing Life Sciences

TLS Online
Nurturing Life Sciences

If the equilibrium constant, Keq, for the reaction ATP → ADP + Pi is 2.22 × 10⁵ M, calculate the standard free-energy change, ΔG°, for the synthesis of ATP from ADP and Pi at 25 °C.