TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 12940
#SCPH28 | Zoology
Choose the correct order for the steps involve in Protein engineering.
1. Protein modelling
2. Protein crystallography
3. Site-directed mutations
4. Comparison with entries in databases of known proteins.
TLS Online TPP Program
#Question id: 13101
#SCPH28 | Zoology
You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?
TLS Online TPP Program
#Question id: 6982
#SCPH28 | Zoology
Which of the following genes control the final structures of appendages from each segment?
TLS Online TPP Program
#Question id: 2640
#SCPH01 Biochemistry
Which of these properties do not agree with trp operon attenuator?
TLS Online TPP Program
#Question id: 12577
#SCPH06 I Botany
During a field trip, an instructor touched a moth resting on a tree trunk. The moth raised its forewings to reveal large eyespots on its hind wings. The instructor asked why the moth lifted its wings. One student answered that sensory receptors had fired and triggered a neuronal reflex culminating in the contraction of certain muscles. A second student responded that the behaviour might frighten predators. Which statement best describes these explanations?