Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 51077
TLS Online TPP Program

#Question id: 410

For the reaction A -> B, the Keq' is 10^4.  If a reaction mixture originally contains 1 mmol of A and no B, which one of the following must be true?

#SCPH01 Biochemistry

  1. At equilibrium, there will be far more B than A.

  2. The rate of the reaction is very slow.

  3. The reaction requires coupling to an exergonic reaction in order to proceed.

  4. The reaction will proceed toward B at a very high rate.

More Questions
TLS Online TPP Program

#Question id: 3543

#SCPH01 Biochemistry

Mendel crossed round and tall pea plants (RRTT) with wrinkle and dwarf ones (rrtt). The F1 plants were all round tall. These F1 plants were cross with rrTt. Which of the following is correct among these offspring?
TLS Online TPP Program

#Question id: 14487

#SCPH01 Biochemistry

What is the probability of a particular person getting 9 cards of the same suit in one hand at a game of bridge where 13 cards are dealt to a person ?
TLS Online TPP Program

#Question id: 3905

#SCPH28 | Zoology

Which is not a property of RNA polymerase?
TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 2261

#SCPH05 I Biotechnology

Oxidative metabolism is carried out ____ of mitochondria.