In plasma clot the explant is cultured on the surface of a clot help to to study the action of

TLS Online TPP Program

#Question id: 8925

#I Life Science/ Life Sciences Group – I-V

What is the probable sequence in which the following clades of animals originated, from earliest to most recent?

1. tetrapods

2. vertebrates

3. deuterostomes

4. amniotes

5. bilaterians

TLS Online TPP Program

#Question id: 12753

#SCPH06 I Botany

Property of CTAB to precipitate plant DNA is because of presence of --------- in the DNA?

TLS Online TPP Program

#Question id: 13096

#SCPH06 I Botany

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 8842

#SCPH28 | Zoology

In terms of the hierarchical organization of life, a bacterium is at the __________ level of organization, whereas a human is at the __________ level of organization

TLS Online TPP Program

#Question id: 15182

#SCPH05 I Biotechnology

Which of the following types of effect are responsible for lowering the efficiency of electrophoresis?